cell culture c2c12 myoblasts Search Results


99
ATCC mouse myoblast c2c12 cell line
Mouse Myoblast C2c12 Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse myoblast c2c12 cell line/product/ATCC
Average 99 stars, based on 1 article reviews
mouse myoblast c2c12 cell line - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

99
Oxford Instruments wt c2c12 myoblasts
Wt C2c12 Myoblasts, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wt c2c12 myoblasts/product/Oxford Instruments
Average 99 stars, based on 1 article reviews
wt c2c12 myoblasts - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

90
European Collection of Authenticated Cell Cultures c2c12 cell line
C2c12 Cell Line, supplied by European Collection of Authenticated Cell Cultures, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c2c12 cell line/product/European Collection of Authenticated Cell Cultures
Average 90 stars, based on 1 article reviews
c2c12 cell line - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
ATCC c2c12 crl 1722 myoblast cells
(A) Morphology of <t>C2C12</t> myoblasts and myotubes (B) Western blot comparison of PrP C expression from mouse brain homogenate, C2C12 myoblasts and myotubes and N2a neuroblastoma cells. Relative loads are based on protein concentration of the brain homogenate (1.78 µg, 0.68 µg protein) and cell lysates (3.4 µg C2C12 myoblasts, myotubes and N2a). Anti-PrP antibody SAF 83 was used.
C2c12 Crl 1722 Myoblast Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c2c12 crl 1722 myoblast cells/product/ATCC
Average 95 stars, based on 1 article reviews
c2c12 crl 1722 myoblast cells - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
KAC Co Ltd mouse c2c12 myoblasts
(A) Morphology of <t>C2C12</t> myoblasts and myotubes (B) Western blot comparison of PrP C expression from mouse brain homogenate, C2C12 myoblasts and myotubes and N2a neuroblastoma cells. Relative loads are based on protein concentration of the brain homogenate (1.78 µg, 0.68 µg protein) and cell lysates (3.4 µg C2C12 myoblasts, myotubes and N2a). Anti-PrP antibody SAF 83 was used.
Mouse C2c12 Myoblasts, supplied by KAC Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse c2c12 myoblasts/product/KAC Co Ltd
Average 90 stars, based on 1 article reviews
mouse c2c12 myoblasts - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Procell Inc mouse c2c12 myoblasts
(A) Morphology of <t>C2C12</t> myoblasts and myotubes (B) Western blot comparison of PrP C expression from mouse brain homogenate, C2C12 myoblasts and myotubes and N2a neuroblastoma cells. Relative loads are based on protein concentration of the brain homogenate (1.78 µg, 0.68 µg protein) and cell lysates (3.4 µg C2C12 myoblasts, myotubes and N2a). Anti-PrP antibody SAF 83 was used.
Mouse C2c12 Myoblasts, supplied by Procell Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse c2c12 myoblasts/product/Procell Inc
Average 90 stars, based on 1 article reviews
mouse c2c12 myoblasts - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

c2c12  (DSMZ)
94
DSMZ c2c12
Cap1 mRNA and protein levels are downregulated during myogenic differentiation. (A,E) Bright-field images (×20) of murine <t>C2C12</t> (A) and human LHCN-M2 (E) cells upon differentiation for 4 and 6 days (d4 and d6), in comparison to undifferentiated control cells (d0). Cells were stained with crystal violet. (B,F) Relative Cap1 mRNA in differentiating C2C12 (B) and LHCN-M2 (F) cells, quantified by qRT-PCR and normalized to a set of housekeeping mRNAs. (C,G) Immunoblots of lysates from differentiating C2C12 (C) and LHCN-M2 (G) cells, using antibodies against myosin heavy chain polypeptides 1, 2, 4, and 6 (MYH), CAP1 and GAPDH as a control. (D,H) Quantification of CAP1 immunoblots at myogenic differentiation for 4 and 6 days, normalized to undifferentiated control cells. Error bars , SEM ( n = 3); ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.
C2c12, supplied by DSMZ, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c2c12/product/DSMZ
Average 94 stars, based on 1 article reviews
c2c12 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology c2c12 cells
Fig. 1. Expression and subcellular localization of TRPC1 in <t>C2C12</t> myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.
C2c12 Cells, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c2c12 cells/product/Santa Cruz Biotechnology
Average 95 stars, based on 1 article reviews
c2c12 cells - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Dainippon Sumitomo mouse myoblastic c2c12 cells
Fig. 1. Expression and subcellular localization of TRPC1 in <t>C2C12</t> myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.
Mouse Myoblastic C2c12 Cells, supplied by Dainippon Sumitomo, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse myoblastic c2c12 cells/product/Dainippon Sumitomo
Average 90 stars, based on 1 article reviews
mouse myoblastic c2c12 cells - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
MedChemExpress c2c12 myotubes
( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating <t>C2C12</t> cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.
C2c12 Myotubes, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c2c12 myotubes/product/MedChemExpress
Average 96 stars, based on 1 article reviews
c2c12 myotubes - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
DS Pharma Biomedical murine c2c12 myoblasts ecacc: 91031101
( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating <t>C2C12</t> cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.
Murine C2c12 Myoblasts Ecacc: 91031101, supplied by DS Pharma Biomedical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/murine c2c12 myoblasts ecacc: 91031101/product/DS Pharma Biomedical
Average 90 stars, based on 1 article reviews
murine c2c12 myoblasts ecacc: 91031101 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
BioResource International Inc c2c12 mouse adherent myoblasts
IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) <t>C2C12</t> cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.
C2c12 Mouse Adherent Myoblasts, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c2c12 mouse adherent myoblasts/product/BioResource International Inc
Average 90 stars, based on 1 article reviews
c2c12 mouse adherent myoblasts - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


(A) Morphology of C2C12 myoblasts and myotubes (B) Western blot comparison of PrP C expression from mouse brain homogenate, C2C12 myoblasts and myotubes and N2a neuroblastoma cells. Relative loads are based on protein concentration of the brain homogenate (1.78 µg, 0.68 µg protein) and cell lysates (3.4 µg C2C12 myoblasts, myotubes and N2a). Anti-PrP antibody SAF 83 was used.

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: (A) Morphology of C2C12 myoblasts and myotubes (B) Western blot comparison of PrP C expression from mouse brain homogenate, C2C12 myoblasts and myotubes and N2a neuroblastoma cells. Relative loads are based on protein concentration of the brain homogenate (1.78 µg, 0.68 µg protein) and cell lysates (3.4 µg C2C12 myoblasts, myotubes and N2a). Anti-PrP antibody SAF 83 was used.

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Western Blot, Comparison, Expressing, Protein Concentration

(A) C2C12 myotubes infected with RML were collected at 4 or 15 days post infection by scraping in PBS, centrifuging and resuspending in 500 µL of water. 30 µL of this cell material was inoculated intracranially into weanling C57Bl/6 mice. A statistically significant difference in incubation period was observed between 4 and 15 days indicative of prion replication p<0.05. Parallel inoculation of serial 10-fold dilutions of RML brain homogenates were performed. (B) Plot of infectivity in each inocula standardized per gram of protein inoculated. C2C12 myotubes infected with RML were collected at 4, 6, 8, 10, 13 and 15 days post-infection as in (A) and bioassayed. Infectivity of the C2C12 derived samples was calculated by comparing the observed incubation periods from each sample with those from brain homogenate dilutions and normalizing the data to protein content. Prion infectivity increases in C2C12 myotube cultures from day 4 to day 15 post-infection.

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: (A) C2C12 myotubes infected with RML were collected at 4 or 15 days post infection by scraping in PBS, centrifuging and resuspending in 500 µL of water. 30 µL of this cell material was inoculated intracranially into weanling C57Bl/6 mice. A statistically significant difference in incubation period was observed between 4 and 15 days indicative of prion replication p<0.05. Parallel inoculation of serial 10-fold dilutions of RML brain homogenates were performed. (B) Plot of infectivity in each inocula standardized per gram of protein inoculated. C2C12 myotubes infected with RML were collected at 4, 6, 8, 10, 13 and 15 days post-infection as in (A) and bioassayed. Infectivity of the C2C12 derived samples was calculated by comparing the observed incubation periods from each sample with those from brain homogenate dilutions and normalizing the data to protein content. Prion infectivity increases in C2C12 myotube cultures from day 4 to day 15 post-infection.

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Infection, Incubation, Derivative Assay

Gene expression profiling was performed from 3 replicate samples of uninfected and infected C2C12 myotube preparations. (A) Confirmation of PrP Sc in cells used for gene expression profiling by immunoblotting with 3F10. Cell lysates were digested with 50 ug/mL of proteinase K (PK50) and 10 µg of protein was loaded in each lane. (B) Gene expression of infected vs. un-infected control cell cultures (N = 3). A scatter plot was created comparing the expression of genes in uninfected cells with that of infected cells. Each data point plotted is the average normalized signal intensity for each gene's expression (uninfected or infected). Data points outside the green lines have greater than 2-fold changes in gene expression. Transcription was globally unchanged in C2C12 cells replicating PrP Sc .

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: Gene expression profiling was performed from 3 replicate samples of uninfected and infected C2C12 myotube preparations. (A) Confirmation of PrP Sc in cells used for gene expression profiling by immunoblotting with 3F10. Cell lysates were digested with 50 ug/mL of proteinase K (PK50) and 10 µg of protein was loaded in each lane. (B) Gene expression of infected vs. un-infected control cell cultures (N = 3). A scatter plot was created comparing the expression of genes in uninfected cells with that of infected cells. Each data point plotted is the average normalized signal intensity for each gene's expression (uninfected or infected). Data points outside the green lines have greater than 2-fold changes in gene expression. Transcription was globally unchanged in C2C12 cells replicating PrP Sc .

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Gene Expression, Infection, Western Blot, Control, Expressing

(A) Time dependent increase in PrP Sc in C2C12 cells. 10 µg of protein (PK−) or protein equivalent (PK+) was loaded in each lane. (B) Relative abundance of PrP Sc in clinically affected mouse brain homogenate and lysates from cell lines (C2C12 myotubes, N2a neuroblastoma cells and SMB scrapie mouse brain cells). All samples are treated with PK (50 µg/mL, final concentration). Relative loading is equivalent to protein amounts prior to proteinase K digestion 0.75 µg, 7.5 µg and 75 µg respectively. Antibody SAF 83 was used.

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: (A) Time dependent increase in PrP Sc in C2C12 cells. 10 µg of protein (PK−) or protein equivalent (PK+) was loaded in each lane. (B) Relative abundance of PrP Sc in clinically affected mouse brain homogenate and lysates from cell lines (C2C12 myotubes, N2a neuroblastoma cells and SMB scrapie mouse brain cells). All samples are treated with PK (50 µg/mL, final concentration). Relative loading is equivalent to protein amounts prior to proteinase K digestion 0.75 µg, 7.5 µg and 75 µg respectively. Antibody SAF 83 was used.

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Concentration Assay

C2C12 cells were infected with 100 µL of 10% brain homogenates. Two days post infection, pentosan polysulfate (PPS) (1 µg/ml final concentration) was added to the media. PPS was kept on the cells until harvested at the designated dates. Antibody SAF 83 was used for western blot detection.

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: C2C12 cells were infected with 100 µL of 10% brain homogenates. Two days post infection, pentosan polysulfate (PPS) (1 µg/ml final concentration) was added to the media. PPS was kept on the cells until harvested at the designated dates. Antibody SAF 83 was used for western blot detection.

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Infection, Concentration Assay, Western Blot

(A) Brain homogenates (BH) from mice clinically affected with prion disease. 10 ul of 1% BH treated with or without 50 µg/ml PK was loaded in each lane. 22L and ME7 prions were generated in tga20 mice. RML prions were from C57Bl/6 mice. PrP Sc was detected with 3F10 antibody. (B) C2C12 cells were infected with brain homogenates from 22L, ME7 and RML. At 4, 8 and 14 days post exposure, cells were lysed, lysates treated with 50 ug/mL of proteinase K and immunoblotted to detect the presence of PrP Sc . 30 µg of protein equivalent was loaded into each lane for 22L and ME7 samples. 10 µl of 0.1% BH was loaded as a control. 10 µg of protein equivalent from RML infected myotubes was loaded.

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: (A) Brain homogenates (BH) from mice clinically affected with prion disease. 10 ul of 1% BH treated with or without 50 µg/ml PK was loaded in each lane. 22L and ME7 prions were generated in tga20 mice. RML prions were from C57Bl/6 mice. PrP Sc was detected with 3F10 antibody. (B) C2C12 cells were infected with brain homogenates from 22L, ME7 and RML. At 4, 8 and 14 days post exposure, cells were lysed, lysates treated with 50 ug/mL of proteinase K and immunoblotted to detect the presence of PrP Sc . 30 µg of protein equivalent was loaded into each lane for 22L and ME7 samples. 10 µl of 0.1% BH was loaded as a control. 10 µg of protein equivalent from RML infected myotubes was loaded.

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Generated, Infection, Control

15 µg of protein was loaded in each lane. RML and HY brain homogenates were 15 µl of 0.1% (A) C2C12 myotubes infected with RML accumulate PrP Sc as detected by the SAF83 monoclonal antibody. SAF 83 recognizes mouse and hamster PrP. (B, C) C2C12 myotubes infected with hamster HY prions probed with SAF83 (B) and 3F4 (C) antibodies. 3F4 recognizes hamster PrP but not mouse, including some HY that persists in culture until day five. SAF83 also recognizes mouse prions, but no signal is detected at day 5. This is likely due to the higher affinity of 3F4 vs. the SAF83 antibody.

Journal: PLoS Pathogens

Article Title: Infectious Prions Accumulate to High Levels in Non Proliferative C2C12 Myotubes

doi: 10.1371/journal.ppat.1003755

Figure Lengend Snippet: 15 µg of protein was loaded in each lane. RML and HY brain homogenates were 15 µl of 0.1% (A) C2C12 myotubes infected with RML accumulate PrP Sc as detected by the SAF83 monoclonal antibody. SAF 83 recognizes mouse and hamster PrP. (B, C) C2C12 myotubes infected with hamster HY prions probed with SAF83 (B) and 3F4 (C) antibodies. 3F4 recognizes hamster PrP but not mouse, including some HY that persists in culture until day five. SAF83 also recognizes mouse prions, but no signal is detected at day 5. This is likely due to the higher affinity of 3F4 vs. the SAF83 antibody.

Article Snippet: C2C12 (CRL-1722) myoblast cells were purchased from the American Type Culture Collection, expanded and aliquots stored in liquid nitrogen and expanded as needed.

Techniques: Infection

Cap1 mRNA and protein levels are downregulated during myogenic differentiation. (A,E) Bright-field images (×20) of murine C2C12 (A) and human LHCN-M2 (E) cells upon differentiation for 4 and 6 days (d4 and d6), in comparison to undifferentiated control cells (d0). Cells were stained with crystal violet. (B,F) Relative Cap1 mRNA in differentiating C2C12 (B) and LHCN-M2 (F) cells, quantified by qRT-PCR and normalized to a set of housekeeping mRNAs. (C,G) Immunoblots of lysates from differentiating C2C12 (C) and LHCN-M2 (G) cells, using antibodies against myosin heavy chain polypeptides 1, 2, 4, and 6 (MYH), CAP1 and GAPDH as a control. (D,H) Quantification of CAP1 immunoblots at myogenic differentiation for 4 and 6 days, normalized to undifferentiated control cells. Error bars , SEM ( n = 3); ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Journal: Frontiers in Cell and Developmental Biology

Article Title: miRNA mediated downregulation of cyclase-associated protein 1 (CAP1) is required for myoblast fusion

doi: 10.3389/fcell.2022.899917

Figure Lengend Snippet: Cap1 mRNA and protein levels are downregulated during myogenic differentiation. (A,E) Bright-field images (×20) of murine C2C12 (A) and human LHCN-M2 (E) cells upon differentiation for 4 and 6 days (d4 and d6), in comparison to undifferentiated control cells (d0). Cells were stained with crystal violet. (B,F) Relative Cap1 mRNA in differentiating C2C12 (B) and LHCN-M2 (F) cells, quantified by qRT-PCR and normalized to a set of housekeeping mRNAs. (C,G) Immunoblots of lysates from differentiating C2C12 (C) and LHCN-M2 (G) cells, using antibodies against myosin heavy chain polypeptides 1, 2, 4, and 6 (MYH), CAP1 and GAPDH as a control. (D,H) Quantification of CAP1 immunoblots at myogenic differentiation for 4 and 6 days, normalized to undifferentiated control cells. Error bars , SEM ( n = 3); ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Article Snippet: C2C12 (DSMZ—German Collection of Microorganisms and Cell Cultures) was cultured subconfluently in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic-antimycotic (Thermo Fisher) at 37°C and 5% CO 2 .

Techniques: Comparison, Control, Staining, Quantitative RT-PCR, Western Blot

Knockout of Cap1 results in increased size of cells and nuclei and accumulated F-actin fibers in C2C12 cells. (A) Validation of partial knockout by CRISPR-Cas9 (sg-Cap1) and overexpression (dsRed-Cap1) in C2C12 pools by immunoblot, compared to control cells infected with Cas9 only (Cas9). The sg-Cap1 cells show reduced expression of endogenous CAP1 while ectopically expressed dsRed-Cap1 results in an additional band corresponding to tagged CAP1 proteins ( n = 3). (B) Quantification of the cell area covered, based on crystal violet staining ( n = 50 cells). (C) Quantification of the nucleus size ( n = 100 nucleus). (D) Micrographs, the upper panel shows fluorescence images of phalloidin-stained cells. The lower panel shows bright-field images (×20) of crystal violet stained cells. Data presented here are from two-week post transduction. The cell and nucleus size quantifications are presented as box plot, showing mean (cross), median (line), 25th and 75th percentile (box). The whiskers extend to the most extreme data points not considered outliers, and the outliers are represented as dots; *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Journal: Frontiers in Cell and Developmental Biology

Article Title: miRNA mediated downregulation of cyclase-associated protein 1 (CAP1) is required for myoblast fusion

doi: 10.3389/fcell.2022.899917

Figure Lengend Snippet: Knockout of Cap1 results in increased size of cells and nuclei and accumulated F-actin fibers in C2C12 cells. (A) Validation of partial knockout by CRISPR-Cas9 (sg-Cap1) and overexpression (dsRed-Cap1) in C2C12 pools by immunoblot, compared to control cells infected with Cas9 only (Cas9). The sg-Cap1 cells show reduced expression of endogenous CAP1 while ectopically expressed dsRed-Cap1 results in an additional band corresponding to tagged CAP1 proteins ( n = 3). (B) Quantification of the cell area covered, based on crystal violet staining ( n = 50 cells). (C) Quantification of the nucleus size ( n = 100 nucleus). (D) Micrographs, the upper panel shows fluorescence images of phalloidin-stained cells. The lower panel shows bright-field images (×20) of crystal violet stained cells. Data presented here are from two-week post transduction. The cell and nucleus size quantifications are presented as box plot, showing mean (cross), median (line), 25th and 75th percentile (box). The whiskers extend to the most extreme data points not considered outliers, and the outliers are represented as dots; *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Article Snippet: C2C12 (DSMZ—German Collection of Microorganisms and Cell Cultures) was cultured subconfluently in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic-antimycotic (Thermo Fisher) at 37°C and 5% CO 2 .

Techniques: Knock-Out, Biomarker Discovery, CRISPR, Over Expression, Western Blot, Control, Infection, Expressing, Staining, Fluorescence, Transduction

Timely downregulation of CAP1 is important for myoblast fusion. (A) Cas9 control cells, knockout (sg-Cap1) and overexpressing (dsRed-Cap1) cells at day 0 (d0), day 4 (d4) and day 6 (d6) of their differentiation. Pools of C2C12 cells were stained for MYH (green) and nucleus (DAPI, orange). (B) Quantification of the percentage of myotubes containing the indicated number of nuclei per myotube in control, knockout and overexpressing myotubes after 6 days of differentiation (minimum 200 MYH positive myotubes were counted). (C) Western blot for the myogenic marker MYH, TUBULIN, MYOG, MYOD, Flag, CAP1, and GAPDH at day 0 (d0), days 4 (d4) and 6 (d6) of the differentiation. (D–G) Quantification of MYH, MYOG, MYOD, and CAP1 immunoblots at myogenic differentiation for 4 and 6 days, normalized to Cas9 control cells. Error bars , SEM ( n = 3); * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Journal: Frontiers in Cell and Developmental Biology

Article Title: miRNA mediated downregulation of cyclase-associated protein 1 (CAP1) is required for myoblast fusion

doi: 10.3389/fcell.2022.899917

Figure Lengend Snippet: Timely downregulation of CAP1 is important for myoblast fusion. (A) Cas9 control cells, knockout (sg-Cap1) and overexpressing (dsRed-Cap1) cells at day 0 (d0), day 4 (d4) and day 6 (d6) of their differentiation. Pools of C2C12 cells were stained for MYH (green) and nucleus (DAPI, orange). (B) Quantification of the percentage of myotubes containing the indicated number of nuclei per myotube in control, knockout and overexpressing myotubes after 6 days of differentiation (minimum 200 MYH positive myotubes were counted). (C) Western blot for the myogenic marker MYH, TUBULIN, MYOG, MYOD, Flag, CAP1, and GAPDH at day 0 (d0), days 4 (d4) and 6 (d6) of the differentiation. (D–G) Quantification of MYH, MYOG, MYOD, and CAP1 immunoblots at myogenic differentiation for 4 and 6 days, normalized to Cas9 control cells. Error bars , SEM ( n = 3); * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Article Snippet: C2C12 (DSMZ—German Collection of Microorganisms and Cell Cultures) was cultured subconfluently in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic-antimycotic (Thermo Fisher) at 37°C and 5% CO 2 .

Techniques: Control, Knock-Out, Staining, Western Blot, Marker

miRNA (miR-1, miR-133, and miR-206) regulate the expression of Cap1 in murine and human myoblast. (A) The abundance of the indicated miRNAs in total lysates of undifferentiated and differentiated C2C12, determined by RNA-Seq. CPM; counts per million ( n = 3). (B) Schematic of the 3′-UTR of murine Cap1 with the STOP-codon at position 1 and the polyadenylation signal at 1,020 and 1,058 bp. Predicted binding sites for miR-1, miR-133 and miR-206 are indicated by yellow boxes. (C,D) Cap1 mRNA expression in undifferentiated C2C12 (C) and LHCN-M2 (D) cells transfected with the indicated miRNA mimic for 72 h ( n = 3). (E,F) Representative immunoblots of cells transfected with the indicated miRNA. (G,H) Quantification of the CAP1 protein from three independent experiments. Error bars, SEM ( n = 3); * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t -test).

Journal: Frontiers in Cell and Developmental Biology

Article Title: miRNA mediated downregulation of cyclase-associated protein 1 (CAP1) is required for myoblast fusion

doi: 10.3389/fcell.2022.899917

Figure Lengend Snippet: miRNA (miR-1, miR-133, and miR-206) regulate the expression of Cap1 in murine and human myoblast. (A) The abundance of the indicated miRNAs in total lysates of undifferentiated and differentiated C2C12, determined by RNA-Seq. CPM; counts per million ( n = 3). (B) Schematic of the 3′-UTR of murine Cap1 with the STOP-codon at position 1 and the polyadenylation signal at 1,020 and 1,058 bp. Predicted binding sites for miR-1, miR-133 and miR-206 are indicated by yellow boxes. (C,D) Cap1 mRNA expression in undifferentiated C2C12 (C) and LHCN-M2 (D) cells transfected with the indicated miRNA mimic for 72 h ( n = 3). (E,F) Representative immunoblots of cells transfected with the indicated miRNA. (G,H) Quantification of the CAP1 protein from three independent experiments. Error bars, SEM ( n = 3); * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t -test).

Article Snippet: C2C12 (DSMZ—German Collection of Microorganisms and Cell Cultures) was cultured subconfluently in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic-antimycotic (Thermo Fisher) at 37°C and 5% CO 2 .

Techniques: Expressing, RNA Sequencing, Binding Assay, Transfection, Western Blot

Requirement of the 3′-UTR for Cap1 regulation during myogenesis. (A) The 3′-UTR of Cap1 was deleted in C2C12 cells using CRISPR/Cas9. Δ3′-UTR (Δ) and Cas9-only (C) control cells were differentiated for the indicated times. Representative immunoblots for MYH and CAP1 are shown. (B) Quantification of CAP1 protein at day 0, day 4 and day 6 of differentiation normalized to day 0. (C) Quantification of MYH, normalized to Cas9 control cells at day 4. (D) Immunofluorescence staining (×20) of C2C12 cells stained with MYH (green) and DAPI (orange) after differentiation for 4 and 6 days (d4 and d6), in comparison to undifferentiated control cells (d0). Thick and multinucleated myotubes are reduced in the Δ3′-UTR cells (right panel) at day 6 of differentiation, compared to the Cas9 control (left panel). Error bars, SEM ( n = 3); * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Journal: Frontiers in Cell and Developmental Biology

Article Title: miRNA mediated downregulation of cyclase-associated protein 1 (CAP1) is required for myoblast fusion

doi: 10.3389/fcell.2022.899917

Figure Lengend Snippet: Requirement of the 3′-UTR for Cap1 regulation during myogenesis. (A) The 3′-UTR of Cap1 was deleted in C2C12 cells using CRISPR/Cas9. Δ3′-UTR (Δ) and Cas9-only (C) control cells were differentiated for the indicated times. Representative immunoblots for MYH and CAP1 are shown. (B) Quantification of CAP1 protein at day 0, day 4 and day 6 of differentiation normalized to day 0. (C) Quantification of MYH, normalized to Cas9 control cells at day 4. (D) Immunofluorescence staining (×20) of C2C12 cells stained with MYH (green) and DAPI (orange) after differentiation for 4 and 6 days (d4 and d6), in comparison to undifferentiated control cells (d0). Thick and multinucleated myotubes are reduced in the Δ3′-UTR cells (right panel) at day 6 of differentiation, compared to the Cas9 control (left panel). Error bars, SEM ( n = 3); * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t -test). Scale bar, 200 μm.

Article Snippet: C2C12 (DSMZ—German Collection of Microorganisms and Cell Cultures) was cultured subconfluently in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic-antimycotic (Thermo Fisher) at 37°C and 5% CO 2 .

Techniques: CRISPR, Control, Western Blot, Immunofluorescence, Staining, Comparison

Model depicting the regulatory circuitry of myogenic C2C12 differentiation via post-transcriptional Cap1 regulation. Under physiological conditions, a timely and necessary downregulation of the Cap1 during myogenesis, is induced by myogenic miRNAs miR-1a-3p, miR-133a-3p, and miR-206-3p whose expression increases manifold during differentiation. The decreased levels of CAP1 increases the F-actin levels that enable myoblasts for elongation, migration and fusion necessary for the myoblasts fusion and myotube maturation. Under experimental conditions, both at the induced overexpression and knockout scenario (on the right side) a decreased fusion index was observed as measured by the thickness of the myotubes as well as the number of the nuclei present in the myosin heavy chain positive myotubes. Endogenous deletion of the Cap1 3′ UTR (on the left side) also resulted in the diminished fusion index similar to the CAP1 overexpressing myoblast. Overall, a timely decrease in the expression of the CAP1 is necessary for myoblast fusion.

Journal: Frontiers in Cell and Developmental Biology

Article Title: miRNA mediated downregulation of cyclase-associated protein 1 (CAP1) is required for myoblast fusion

doi: 10.3389/fcell.2022.899917

Figure Lengend Snippet: Model depicting the regulatory circuitry of myogenic C2C12 differentiation via post-transcriptional Cap1 regulation. Under physiological conditions, a timely and necessary downregulation of the Cap1 during myogenesis, is induced by myogenic miRNAs miR-1a-3p, miR-133a-3p, and miR-206-3p whose expression increases manifold during differentiation. The decreased levels of CAP1 increases the F-actin levels that enable myoblasts for elongation, migration and fusion necessary for the myoblasts fusion and myotube maturation. Under experimental conditions, both at the induced overexpression and knockout scenario (on the right side) a decreased fusion index was observed as measured by the thickness of the myotubes as well as the number of the nuclei present in the myosin heavy chain positive myotubes. Endogenous deletion of the Cap1 3′ UTR (on the left side) also resulted in the diminished fusion index similar to the CAP1 overexpressing myoblast. Overall, a timely decrease in the expression of the CAP1 is necessary for myoblast fusion.

Article Snippet: C2C12 (DSMZ—German Collection of Microorganisms and Cell Cultures) was cultured subconfluently in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic-antimycotic (Thermo Fisher) at 37°C and 5% CO 2 .

Techniques: Expressing, Migration, Over Expression, Knock-Out

Fig. 1. Expression and subcellular localization of TRPC1 in C2C12 myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 1. Expression and subcellular localization of TRPC1 in C2C12 myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Control, Membrane, Western Blot, Transfection, Immunofluorescence, Fluorescence, Immunostaining

Fig. 2. Effect of TRPC1 silencing on stretch-activated Ca2+-transients and SAC currents in C2C12 myoblasts. (A) C2C12 myoblasts were pre-loaded with Fluo3-AM and mechanically stretched with the tip of an AFM probe (thick grey line). Fluorescence images were acquired soon after mechanical stimulation at a rate of 1 image/second using a digital camera. The pseudo- colouring represents the global Ca2+ increase as indicated by the colour bar. Note the marked reduction and the absence of the Ca2+ transient in TRPC1 silenced cells. The images are representative of at least five to six independent experiments with similar results (number of stretched cells for each group=5). (B) Two patch pipettes were attached to the cells at (a) resting length and (b) after 20% cell stretching induced by the movement of the upper pipette in the longitudinal direction. (C) Representative total current traces, (a) Im* recorded in bath solution by whole cell path-clamp; (b) leak current, Im,leak, recorded in the presence of GdCl3 added in the bath solution and (c-j) SAC-mediated current; Im, evaluated by detracting Im,leak from Im*; (c-f) SAC-mediated currents (Im) in SCR- and TRPC1-siRNA cells unstimulated and (g-j) S1P- stimulated evaluated before (c,e,g,i) and after (d,f,h,j) the application of the mechanical stretch; (k,l), currents normalized for Cm elicited by ramp voltage pulses from the same cell reported in panels a-j. siTRPC1, TRPC1-siRNA transfected cells; str, stretched cells.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 2. Effect of TRPC1 silencing on stretch-activated Ca2+-transients and SAC currents in C2C12 myoblasts. (A) C2C12 myoblasts were pre-loaded with Fluo3-AM and mechanically stretched with the tip of an AFM probe (thick grey line). Fluorescence images were acquired soon after mechanical stimulation at a rate of 1 image/second using a digital camera. The pseudo- colouring represents the global Ca2+ increase as indicated by the colour bar. Note the marked reduction and the absence of the Ca2+ transient in TRPC1 silenced cells. The images are representative of at least five to six independent experiments with similar results (number of stretched cells for each group=5). (B) Two patch pipettes were attached to the cells at (a) resting length and (b) after 20% cell stretching induced by the movement of the upper pipette in the longitudinal direction. (C) Representative total current traces, (a) Im* recorded in bath solution by whole cell path-clamp; (b) leak current, Im,leak, recorded in the presence of GdCl3 added in the bath solution and (c-j) SAC-mediated current; Im, evaluated by detracting Im,leak from Im*; (c-f) SAC-mediated currents (Im) in SCR- and TRPC1-siRNA cells unstimulated and (g-j) S1P- stimulated evaluated before (c,e,g,i) and after (d,f,h,j) the application of the mechanical stretch; (k,l), currents normalized for Cm elicited by ramp voltage pulses from the same cell reported in panels a-j. siTRPC1, TRPC1-siRNA transfected cells; str, stretched cells.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Fluorescence, Transferring, Transfection

Fig. 3. Localization of TRPC1 in lipid microdomains of C2C12 myoblasts: effects of cholesterol depletion. (A) Localization of endogenous TRPC1 in lipid microdomains. Lipid-raft (DRM) and high-density (HDM) fractions were prepared as reported in Materials and Methods. An aliquot of each fraction (20 μl, 1/25 of total volume of 1-11 fractions) was resolved by SDS-PAGE and anti-caveolin 1 (Cav1), anti-TRPC1 and anti-calnexin immunodetected. A blot representative of three independent experiments with similar results is reported. (B) Sphingolipid content measurements. Sucrose density gradient fractions were prepared from [3H]sphingosine-labelled cells as described in Materials and Methods. Total radioactivity of unfractionated [3H]sphingolipids was determined in each fraction and reported as mean ± s.e.m. of a representative experiment performed in duplicate with similar results. (C) Co-immunoprecipitation of TRPC1 and Cav1. Pooled DRM fractions (F3-F4) obtained from C2C12 cell fractionation were subjected to immunoprecipitation with rabbit polyclonal antibodies directed against TRPC1 as described in Materials and Methods and Cav1 immunodetected. A blot, representative of two independent experiments, is reported. (D) Confocal immunofluorescent localization of endogenous TRPC1 in lipid rafts (triple labelling). (a,b) Native C2C12 myoblasts and (d,e) C2C12 cells treated with MβCD for 30 minutes were incubated with Alexa Fluor 488-conjugated CT-B (green) to label lipid rafts, immunostained for TRPC1 (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Inset: magnification of outlined area. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots of the distribution of red and green fluorescence intensity signals. Pixel intensity (PI) for each of the dyes along the lines (AB, CD) in the confocal image g are shown. The degree of co-localization of TRPC1 with CT-B is summarized in the histogram. The images are representative of at least three independent experiments with similar results. (E) Effect of lipid-raft disruption on TRPC1 expression. C2C12 myoblasts were pre-incubated for 30 minutes in media containing vehicle (–) and MβCD (+), collected and processed for lipid-raft (DRM) and high-density membrane fraction (showed fraction 11) purification as described in the Materials and Methods. An equal amount (20 μl) of fractions was evaluated for the presence of TRPC1 and Cav1 by western blotting analysis. A blot representative of three is shown. (F) Effect of MβCD treatment on Gm/Cm. C2C12 cells were incubated for 30 minutes with MβCD in the presence or in the absence of S1P. Transmembrane ion conductance and cell capacitance were analysed by whole cell patch clamp in K+-free bath solution. Data are mean ± s.e.m. of 12-15 different recordings (*P<0.05, **P<0.001).

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 3. Localization of TRPC1 in lipid microdomains of C2C12 myoblasts: effects of cholesterol depletion. (A) Localization of endogenous TRPC1 in lipid microdomains. Lipid-raft (DRM) and high-density (HDM) fractions were prepared as reported in Materials and Methods. An aliquot of each fraction (20 μl, 1/25 of total volume of 1-11 fractions) was resolved by SDS-PAGE and anti-caveolin 1 (Cav1), anti-TRPC1 and anti-calnexin immunodetected. A blot representative of three independent experiments with similar results is reported. (B) Sphingolipid content measurements. Sucrose density gradient fractions were prepared from [3H]sphingosine-labelled cells as described in Materials and Methods. Total radioactivity of unfractionated [3H]sphingolipids was determined in each fraction and reported as mean ± s.e.m. of a representative experiment performed in duplicate with similar results. (C) Co-immunoprecipitation of TRPC1 and Cav1. Pooled DRM fractions (F3-F4) obtained from C2C12 cell fractionation were subjected to immunoprecipitation with rabbit polyclonal antibodies directed against TRPC1 as described in Materials and Methods and Cav1 immunodetected. A blot, representative of two independent experiments, is reported. (D) Confocal immunofluorescent localization of endogenous TRPC1 in lipid rafts (triple labelling). (a,b) Native C2C12 myoblasts and (d,e) C2C12 cells treated with MβCD for 30 minutes were incubated with Alexa Fluor 488-conjugated CT-B (green) to label lipid rafts, immunostained for TRPC1 (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Inset: magnification of outlined area. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots of the distribution of red and green fluorescence intensity signals. Pixel intensity (PI) for each of the dyes along the lines (AB, CD) in the confocal image g are shown. The degree of co-localization of TRPC1 with CT-B is summarized in the histogram. The images are representative of at least three independent experiments with similar results. (E) Effect of lipid-raft disruption on TRPC1 expression. C2C12 myoblasts were pre-incubated for 30 minutes in media containing vehicle (–) and MβCD (+), collected and processed for lipid-raft (DRM) and high-density membrane fraction (showed fraction 11) purification as described in the Materials and Methods. An equal amount (20 μl) of fractions was evaluated for the presence of TRPC1 and Cav1 by western blotting analysis. A blot representative of three is shown. (F) Effect of MβCD treatment on Gm/Cm. C2C12 cells were incubated for 30 minutes with MβCD in the presence or in the absence of S1P. Transmembrane ion conductance and cell capacitance were analysed by whole cell patch clamp in K+-free bath solution. Data are mean ± s.e.m. of 12-15 different recordings (*P<0.05, **P<0.001).

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: SDS Page, Radioactivity, Immunoprecipitation, Cell Fractionation, Incubation, Fluorescence, Disruption, Expressing, Membrane, Purification, Western Blot, Patch Clamp

Fig. 4. Effects of stress fibre formation and cytoskeletal integrity on TRPC1-cortactin interaction, channel expression and localization. (A) Co-immunoprecipitation of TRPC1 with cortactin. C2C12 cells were incubated in the presence or absence (–) of 1 μM S1P or of 1 μg/ml DHCB, for 30 minutes and collected in lysis buffer and immunoprecipitation performed as reported in the Materials and Methods and Fig. 3C. A blot representative of three independent experiments of immunoprecipitation and TRPC1 immunoblot is shown (relative percentage is reported as mean ± s.e.m.). (B) Confocal immunofluorescence analysis of TRPC1 lipid microdomain localization (triple labelling). C2C12 myoblasts treated with (a,b) DHCB to inhibit actin polymerization or (d,e) S1P to induce stress fibre formation, were incubated with Alexa Fluor 488-conjugated CT-B (green), processed for TRPC1 immunostaining (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots indicate the distribution of TRPC1 and lipid-raft fluorescence intensity signals. The images are representative of at least three independent experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 4. Effects of stress fibre formation and cytoskeletal integrity on TRPC1-cortactin interaction, channel expression and localization. (A) Co-immunoprecipitation of TRPC1 with cortactin. C2C12 cells were incubated in the presence or absence (–) of 1 μM S1P or of 1 μg/ml DHCB, for 30 minutes and collected in lysis buffer and immunoprecipitation performed as reported in the Materials and Methods and Fig. 3C. A blot representative of three independent experiments of immunoprecipitation and TRPC1 immunoblot is shown (relative percentage is reported as mean ± s.e.m.). (B) Confocal immunofluorescence analysis of TRPC1 lipid microdomain localization (triple labelling). C2C12 myoblasts treated with (a,b) DHCB to inhibit actin polymerization or (d,e) S1P to induce stress fibre formation, were incubated with Alexa Fluor 488-conjugated CT-B (green), processed for TRPC1 immunostaining (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots indicate the distribution of TRPC1 and lipid-raft fluorescence intensity signals. The images are representative of at least three independent experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Immunoprecipitation, Incubation, Lysis, Western Blot, Immunofluorescence, Immunostaining, Fluorescence

Fig. 5. Effect of TRPC1 silencing on skeletal myogenic differentiation of C2C12 myoblasts. (A) Western analysis of TRPC1 silencing on the expression of myogenic markers. Confluent C2C12 myoblasts were transfected with SCR-siRNA (–) or TRPC1-siRNA (+), stimulated with (+) or without (–) 1 μM S1P and differentiation started as described in the Materials and Methods. The content of TRPC1, myogenin and α-sarcomeric actin were analysed by western blotting. A blot representative of at least three independent experiments with similar results and the relative percentage is shown (mean ± s.e.m.). (B) Confocal immunofluorescence and phase-contrast analysis of differentiating myoblasts. SCR-siRNA and TRPC1-siRNA cells were cultured on glass coverslips in DM, fixed and stained with the primary antibody against myogenin (green), and counterstained with TRITC-phalloidin to detect actin filaments (red). Parallel experiments were performed to reveal myotube formation by phase contrast. Note that silenced cells reveal reduced nuclear myogenin staining and polyhedral morphology typical of the undifferentiated cells and are unable to form multinucleate myotubes compared to SCR-siRNA cells. The images are representative of at least three separate experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 5. Effect of TRPC1 silencing on skeletal myogenic differentiation of C2C12 myoblasts. (A) Western analysis of TRPC1 silencing on the expression of myogenic markers. Confluent C2C12 myoblasts were transfected with SCR-siRNA (–) or TRPC1-siRNA (+), stimulated with (+) or without (–) 1 μM S1P and differentiation started as described in the Materials and Methods. The content of TRPC1, myogenin and α-sarcomeric actin were analysed by western blotting. A blot representative of at least three independent experiments with similar results and the relative percentage is shown (mean ± s.e.m.). (B) Confocal immunofluorescence and phase-contrast analysis of differentiating myoblasts. SCR-siRNA and TRPC1-siRNA cells were cultured on glass coverslips in DM, fixed and stained with the primary antibody against myogenin (green), and counterstained with TRITC-phalloidin to detect actin filaments (red). Parallel experiments were performed to reveal myotube formation by phase contrast. Note that silenced cells reveal reduced nuclear myogenin staining and polyhedral morphology typical of the undifferentiated cells and are unable to form multinucleate myotubes compared to SCR-siRNA cells. The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Western Blot, Expressing, Transfection, Immunofluorescence, Cell Culture, Staining

Fig. 6. TRPC1 expression during C2C12 myoblasts differentiation. C2C12 cells were grown until 95% confluence and then cultured for the indicated times in DM. (A) Western blotting analysis of TRPC1 expression. Cell lysates (30 μg) were prepared as described in the Materials and Methods and processed for western blotting analysis. A blot representative of three independent experiments with analogous results is shown. (B) Confocal immunofluorescence analysis showing TRPC1 expression in differentiating myoblasts. Cells at the indicated time were fixed and immunostained for TRPC1 (green). Counterstaining was performed with TRITC-conjugated phalloidin to reveal actin filament organization (red). The images are representative of at least three separate experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 6. TRPC1 expression during C2C12 myoblasts differentiation. C2C12 cells were grown until 95% confluence and then cultured for the indicated times in DM. (A) Western blotting analysis of TRPC1 expression. Cell lysates (30 μg) were prepared as described in the Materials and Methods and processed for western blotting analysis. A blot representative of three independent experiments with analogous results is shown. (B) Confocal immunofluorescence analysis showing TRPC1 expression in differentiating myoblasts. Cells at the indicated time were fixed and immunostained for TRPC1 (green). Counterstaining was performed with TRITC-conjugated phalloidin to reveal actin filament organization (red). The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Cell Culture, Western Blot, Immunofluorescence

Fig. 7. Regulation of TRPC1 expression by known modulators of skeletal myogenesis. (A) Western blotting analysis of TRPC1 expression. C2C12 myoblasts were grown until confluence and cultured in DM in the presence (+) or absence (–) of TGFβ (1 ng/ml). Aliquots of proteins from cell extracts (25 μg) were subjected to western blotting. Proteins were immunodetected using specific anti-TRPC1, myogenin and α-sarcomeric actin antibodies. A blot representative of at least three independent experiments with analogous results and the relative percentage (s.e.m. less than 15%) are shown. (B) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on myogenin expression. Confluent C2C12 cells were cultured in DM in the presence of either 1 μM S1P or TGFβ, and stained with specific antibodies. Representative merged confocal fluorescence and DIC contrast images of C2C12 cells immunostained for myogenin (green) are shown. (C) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on TRPC1 expression. Cells processed as in B were stained with anti- TRPC1 antibodies (green). Counterstaining was performed with TRITC- phalloidin to detect actin filaments (red). The images are representative of at least three separate experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 7. Regulation of TRPC1 expression by known modulators of skeletal myogenesis. (A) Western blotting analysis of TRPC1 expression. C2C12 myoblasts were grown until confluence and cultured in DM in the presence (+) or absence (–) of TGFβ (1 ng/ml). Aliquots of proteins from cell extracts (25 μg) were subjected to western blotting. Proteins were immunodetected using specific anti-TRPC1, myogenin and α-sarcomeric actin antibodies. A blot representative of at least three independent experiments with analogous results and the relative percentage (s.e.m. less than 15%) are shown. (B) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on myogenin expression. Confluent C2C12 cells were cultured in DM in the presence of either 1 μM S1P or TGFβ, and stained with specific antibodies. Representative merged confocal fluorescence and DIC contrast images of C2C12 cells immunostained for myogenin (green) are shown. (C) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on TRPC1 expression. Cells processed as in B were stained with anti- TRPC1 antibodies (green). Counterstaining was performed with TRITC- phalloidin to detect actin filaments (red). The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Western Blot, Cell Culture, Immunofluorescence, Staining, Fluorescence

Fig. 8. Effects of TRPC1-siRNA and 2-APB on Gm/Cm in differentiating unstimulated and S1P-stimulated C2C12 myoblasts. C2C12 differentiating cells were transfected with scrambled-siRNA (SCR) and TRPC1-siRNA (siTRPC1) or treated with 2-APB in the presence or in the absence of S1P and incubated in DM for 24 hours. Significance of differences: *P<0.05, **P<0.01 with respect to relative controls; §§P<0.01 of TRPC1-siRNA (siTRPC1) with respect to SCR-siRNA (one-way ANOVA). Data are mean ± s.e.m. of 14-18 independent cell recordings.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 8. Effects of TRPC1-siRNA and 2-APB on Gm/Cm in differentiating unstimulated and S1P-stimulated C2C12 myoblasts. C2C12 differentiating cells were transfected with scrambled-siRNA (SCR) and TRPC1-siRNA (siTRPC1) or treated with 2-APB in the presence or in the absence of S1P and incubated in DM for 24 hours. Significance of differences: *P<0.05, **P<0.01 with respect to relative controls; §§P<0.01 of TRPC1-siRNA (siTRPC1) with respect to SCR-siRNA (one-way ANOVA). Data are mean ± s.e.m. of 14-18 independent cell recordings.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Transfection, Incubation

( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Journal: Mediators of Inflammation

Article Title: Elevation of IL-6 and IL-33 Levels in Serum Associated with Lung Fibrosis and Skeletal Muscle Wasting in a Bleomycin-Induced Lung Injury Mouse Model

doi: 10.1155/2019/7947596

Figure Lengend Snippet: IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Article Snippet: C2C12 mouse adherent myoblasts were obtained from BCRC (Bioresource Collection and Research Center, Hsinchu, Taiwan).

Techniques: Western Blot, Incubation, Recombinant, Software, Control